circad | circRNAs associated with diseases

Circular RNA F-circEA-2a
Gene		Organism	Human
Genome Locus		Build	hg19
Disease	Non-Small Cell Lung Cancer	ICD-10	Malignant neoplasm of bronchus and lung (C34)
DBLink		PMID	30236141
Experimental Method
Sample Type	Tissue and cell lines	Comparison	lung tissues and blood samples from NSCLC patients
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward GCAGAGCCCTGAGTACAAGC Reverse GCTTGGTTGATGATGACATCTTTATG	Statistics	Fold Change : Upregulated pvalue : <0.05
Citation
Tan, S, Sun, D, Pu, W, Gou, Q, Guo, C, Gong, Y, Li, J, Wei, YQ, Liu, L, Zhao, Y, Peng, Y (2018). Circular RNA F-circEA-2a derived from EML4-ALK fusion gene promotes cell migration and invasion in non-small cell lung cancer. Mol. Cancer, 17, 1:138.